Product Details

SNP ID: rs147406823
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:30026872 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTGGGCAGAGAGACGGGGTGGGGGA[G/A]CAAGGAGGAAAGGGGACACCAGTGA
Phenotype: MIM: 604567 MIM: 615175
Polymorphism: G/A, Transition substitution
Allele Nomenclature
Literature Links: C16orf92 PubMed Links

Gene Details

Gene: C16orf92
Gene Name: chromosome 16 open reading frame 92

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001109659.1		Intron			NP_001103129.1
NM_001109660.1		Intron			NP_001103130.1

Gene: DOC2A
Gene Name: double C2 domain alpha

There are no transcripts associated with this gene.

Gene: FAM57B
Gene Name: family with sequence similarity 57 member B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318504.1		Intron			NP_001305433.1
NM_031478.5		Intron			NP_113666.2
XM_005255613.3		Intron			XP_005255670.1
XM_005255614.3		Intron			XP_005255671.1
XM_005255615.2		Intron			XP_005255672.1
XM_017023749.1		Intron			XP_016879238.1
XM_017023750.1		Intron			XP_016879239.1
XM_017023751.1		Intron			XP_016879240.1
XM_017023752.1		Intron			XP_016879241.1
XM_017023753.1		Intron			XP_016879242.1
XM_017023754.1		Intron			XP_016879243.1

View Full Product Details