Product Details

SNP ID: rs145362282
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.13:49534335 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTTGATTGAATTACTTCTCTCTGAG[A/C]CCTTTACCCCAAATCTCTCACCCTC
Phenotype: MIM: 607796 MIM: 607867
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: PHF11 PubMed Links

Gene Details

Gene: PHF11
Gene Name: PHD finger protein 11

There are no transcripts associated with this gene.

Gene: RCBTB1
Gene Name: RCC1 and BTB domain containing protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018191.3		Intron			NP_060661.3
XM_005266441.2		Intron			XP_005266498.1
XM_011535133.1		Intron			XP_011533435.1
XM_011535134.1		Intron			XP_011533436.1
XM_011535135.2		Intron			XP_011533437.1
XM_011535136.2		Intron			XP_011533438.1

Gene: SETDB2-PHF11
Gene Name: SETDB2-PHF11 readthrough

There are no transcripts associated with this gene.

View Full Product Details