Product Details
- SNP ID
-
rs150720649
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.17:74772552 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CTTGGGGGAAACTGAGGACCATGAA[A/G]GAGCAGAAACAGGAGGGCCTCCTCC
- Phenotype
-
MIM: 604990
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
NAT9
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs71361635] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- NAT9
- Gene Name
- N-acetyltransferase 9 (putative)
- Gene
- SLC9A3R1
- Gene Name
- SLC9A3 regulator 1
There are no transcripts associated with this gene.
- Gene
- TMEM104
- Gene Name
- transmembrane protein 104
There are no transcripts associated with this gene.
View Full Product Details