Product Details

SNP ID: rs28730722
Assay Type: Functionally tested
NCBI dbSNP Submissions: 30
Location: Chr.1:151171494 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACTGAAGCTCCGCACATAGGTATTT[C/G]CCTTCATTGCCTCACACAGCTCACT
Phenotype: MIM: 608095 MIM: 605834 MIM: 600607
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: LYSMD1 PubMed Links

Gene Details

Gene: LYSMD1
Gene Name: LysM domain containing 1

There are no transcripts associated with this gene.

Gene: SCNM1
Gene Name: sodium channel modifier 1

There are no transcripts associated with this gene.

Gene: TMOD4
Gene Name: tropomodulin 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_013353.2	737	Missense Mutation	GCA,GGA	A222G	NP_037485.2
XM_011509449.1	737	Missense Mutation	GCA,GGA	A222G	XP_011507751.1
XM_017001089.1	737	Missense Mutation	GCA,GGA	A222G	XP_016856578.1
XM_017001090.1	737	Intron			XP_016856579.1

Gene: TNFAIP8L2-SCNM1
Gene Name: TNFAIP8L2-SCNM1 readthrough

There are no transcripts associated with this gene.

Gene: VPS72
Gene Name: vacuolar protein sorting 72 homolog

There are no transcripts associated with this gene.

View Full Product Details