Product Details
- SNP ID
-
rs79843810
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.3:187197804 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TTCAGGCAGGTGAGTAGCCCAGGAA[A/G]GTGGATCCCTGCAGGCCGCCTCTAG
- Phenotype
-
MIM: 609137
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
LOC101929106
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs74861372] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- LOC101929106
- Gene Name
- uncharacterized LOC101929106
There are no transcripts associated with this gene.
- Gene
- RTP1
- Gene Name
- receptor transporter protein 1
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_153708.2 |
|
Intron |
|
|
NP_714919.2 |
View Full Product Details