Product Details

SNP ID: rs35016366
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:49583283 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATTAACCACCTGCCTGGATACTTCA[C/T]CCAGTGAGGAGACAGACCAAGGTGA
Phenotype: MIM: 616759 MIM: 616633 MIM: 604429
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: NOSIP PubMed Links

Gene Details

Gene: NOSIP
Gene Name: nitric oxide synthase interacting protein

There are no transcripts associated with this gene.

Gene: PRR12
Gene Name: proline rich 12

There are no transcripts associated with this gene.

Gene: PRRG2
Gene Name: proline rich and Gla domain 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000951.2	229	Missense Mutation	CCC,TCC	P22S	NP_000942.1
NM_001316335.1	229	UTR 5			NP_001303264.1
XM_006723286.2	229	Missense Mutation	CCC,TCC	P22S	XP_006723349.1
XM_011527124.1	229	UTR 5			XP_011525426.1

View Full Product Details