Product Details

SNP ID: rs34488963
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:6430095 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTGCCCCGCCACAGGGAGCGGAAGC[C/T]GCCCTCCTGGACCATGCTCTGTAGC
Phenotype: MIM: 603445 MIM: 608746 MIM: 610822
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: KHSRP PubMed Links

Gene Details

Gene: KHSRP
Gene Name: KH-type splicing regulatory protein

There are no transcripts associated with this gene.

Gene: SLC25A23
Gene Name: solute carrier family 25 member 23

There are no transcripts associated with this gene.

Gene: SLC25A41
Gene Name: solute carrier family 25 member 41

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001321298.1	310	Missense Mutation	AGC,GGC	S6G	NP_001308227.1
NM_173637.3	310	Missense Mutation	AGC,GGC	S144G	NP_775908.2
XM_011527926.1	310	Missense Mutation	AGC,GGC	S80G	XP_011526228.1

View Full Product Details