Product Details
- SNP ID
-
rs7499355
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.16:56617609 on Build GRCh38
- Set Membership
-
HapMap
- Context Sequence [VIC/FAM]
- GCCACTGGTAAGGGAACCCCGGCTC[C/T]GCGCCTGGGAATGCCCAATTCCCAG
- Phenotype
-
MIM: 156351
MIM: 156358
MIM: 156360
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
MT1E
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs80248054] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- MT1E
- Gene Name
- metallothionein 1E
There are no transcripts associated with this gene.
- Gene
- MT1L
- Gene Name
- metallothionein 1L (gene/pseudogene)
There are no transcripts associated with this gene.
- Gene
- MT2A
- Gene Name
- metallothionein 2A
There are no transcripts associated with this gene.
View Full Product Details