Product Details

SNP ID

rs12656423

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.5:69273432 on Build GRCh38

Set Membership

HapMap

Context Sequence [VIC/FAM]

CTTGTAGCAATGCTGAAAGTAGTTT[A/G]TTCGGCTTATTTTTTCTTTCCTATA

Phenotype

MIM: 613781 MIM: 601955

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

CCDC125 PubMed Links

Additional Information

For this assay, SNP(s) [rs112988930] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

CCDC125

Gene Name

coiled-coil domain containing 125

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001297696.1	1573	Intron			NP_001284625.1
NM_001297697.1	1573	Intron			NP_001284626.1
NM_176816.4	1573	Intron			NP_789786.2
XM_005248458.4	1573	Intron			XP_005248515.1
XM_005248459.4	1573	Intron			XP_005248516.1
XM_005248461.3	1573	Intron			XP_005248518.1
XM_005248463.3	1573	Intron			XP_005248520.1
XM_005248464.3	1573	Intron			XP_005248521.1
XM_006714569.3	1573	Intron			XP_006714632.1
XM_006714570.3	1573	Intron			XP_006714633.1
XM_011543255.2	1573	Intron			XP_011541557.1
XM_011543256.2	1573	Intron			XP_011541558.1
XM_011543257.2	1573	Intron			XP_011541559.1
XM_011543258.2	1573	UTR 3			XP_011541560.1
XM_011543259.2	1573	Intron			XP_011541561.1
XM_011543260.2	1573	Intron			XP_011541562.1
XM_017009206.1	1573	Intron			XP_016864695.1
XM_017009207.1	1573	Intron			XP_016864696.1
XM_017009208.1	1573	Intron			XP_016864697.1
XM_017009209.1	1573	Intron			XP_016864698.1
XM_017009210.1	1573	Intron			XP_016864699.1
XM_017009211.1	1573	Intron			XP_016864700.1

Gene

CDK7

Gene Name

cyclin dependent kinase 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001324069.1	1573	Intron			NP_001310998.1
NM_001324070.1	1573	Intron			NP_001310999.1
NM_001324071.1	1573	Intron			NP_001311000.1
NM_001324072.1	1573	Intron			NP_001311001.1
NM_001324074.1	1573	Intron			NP_001311003.1
NM_001324075.1	1573	Intron			NP_001311004.1
NM_001324077.1	1573	Intron			NP_001311006.1
NM_001324078.1	1573	Intron			NP_001311007.1
NM_001799.3	1573	Intron			NP_001790.1
XM_011543094.2	1573	Intron			XP_011541396.1

View Full Product Details