Product Details

SNP ID: rs462007
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.21:44647263 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCCTCCTGCCAGTCCAGCTGCTGC[C/T]GCCCGGCCTCCTGCGTGTCCCTCCT
Phenotype: MIM: 612920
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: KRTAP10-10 PubMed Links

Gene Details

Gene: KRTAP10-10
Gene Name: keratin associated protein 10-10

There are no transcripts associated with this gene.

Gene: KRTAP10-11
Gene Name: keratin associated protein 10-11

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_198692.2	850	Missense Mutation	CGC,TGC	R269C	NP_941965.2

Gene: KRTAP12-4
Gene Name: keratin associated protein 12-4

There are no transcripts associated with this gene.

Gene: TSPEAR
Gene Name: thrombospondin type laminin G domain and EAR repeats

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001272037.1	850	Intron			NP_001258966.1
NM_144991.2	850	Intron			NP_659428.2

View Full Product Details