Product Details

SNP ID: rs2298164
Assay Type: Functionally tested
NCBI dbSNP Submissions: 7
Location: Chr.1:150283594 on Build GRCh38
Set Membership: JSNP
Context Sequence [VIC/FAM]: AACTGGAGACCAGTCTAAACACCCA[A/G]GGTTGTACCACAGAGGGAGACCTGC
Phenotype: MIM: 607629 MIM: 615782
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: APH1A PubMed Links

Gene Details

Gene: APH1A
Gene Name: aph-1 homolog A, gamma-secretase subunit

There are no transcripts associated with this gene.

Gene: C1orf54
Gene Name: chromosome 1 open reading frame 54

There are no transcripts associated with this gene.

Gene: CIART
Gene Name: circadian associated repressor of transcription

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001300838.1	404	Silent Mutation	CAA,CAG	Q109Q	NP_001287767.1
NM_001300839.1	404	Silent Mutation	CAA,CAG	Q21Q	NP_001287768.1
NM_001300840.1	404	Silent Mutation	CAA,CAG	Q21Q	NP_001287769.1
NM_001300841.1	404	Silent Mutation	CAA,CAG	Q21Q	NP_001287770.1
NM_144697.3	404	Silent Mutation	CAA,CAG	Q109Q	NP_653298.1
XM_017000378.1	404	UTR 5			XP_016855867.1

View Full Product Details