Product Details

SNP ID: rs237059
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:76734761 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TAATTTTAAGGAATGAAGGCAATGC[C/T]GAGTCAATCTCTTGACAGCTTTAGG
Phenotype: MIM: 604914 MIM: 615262 MIM: 600813
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: JMJD6 PubMed Links

Gene Details

Gene: JMJD6
Gene Name: arginine demethylase and lysine hydroxylase

There are no transcripts associated with this gene.

Gene: METTL23
Gene Name: methyltransferase like 23

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001080510.4	2317	Intron			NP_001073979.3
NM_001206983.2	2317	Intron			NP_001193912.1
NM_001206984.2	2317	Intron			NP_001193913.1
NM_001206985.2	2317	Intron			NP_001193914.1
NM_001206986.2	2317	Intron			NP_001193915.1
NM_001206987.2	2317	Intron			NP_001193916.1
NM_001302703.1	2317	Intron			NP_001289632.1
NM_001302704.1	2317	Intron			NP_001289633.1
NM_001302705.1	2317	Intron			NP_001289634.1
XM_006721674.3	2317	Intron			XP_006721737.1
XM_006721675.1	2317	Intron			XP_006721738.1
XM_006721676.3	2317	Intron			XP_006721739.1
XM_006721678.3	2317	Intron			XP_006721741.1
XM_006721679.3	2317	Intron			XP_006721742.1
XM_006721680.2	2317	Intron			XP_006721743.1
XM_011524282.1	2317	Intron			XP_011522584.1
XM_017024145.1	2317	Intron			XP_016879634.1
XM_017024146.1	2317	Intron			XP_016879635.1

Gene: MFSD11
Gene Name: major facilitator superfamily domain containing 11

There are no transcripts associated with this gene.

Gene: MIR636
Gene Name: microRNA 636

There are no transcripts associated with this gene.

Gene: SRSF2
Gene Name: serine and arginine rich splicing factor 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001195427.1	2317	UTR 3			NP_001182356.1
NM_003016.4	2317	UTR 3			NP_003007.2
XM_017024942.1	2317	UTR 3			XP_016880431.1

View Full Product Details