Product Details

SNP ID: rs34249798
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:31902406 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCGCCCGCGCCGCATCCCGCAGCGC[G/T]CGCGCGCACCCGTTCTCTCGGCTGC
Phenotype: MIM: 613927 MIM: 604599
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: C2 PubMed Links

Gene Details

Gene: C2
Gene Name: complement component 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000063.5		Intron			NP_000054.2
NM_001145903.2		Intron			NP_001139375.1
NM_001178063.2		Intron			NP_001171534.1
NM_001282457.1		Intron			NP_001269386.1
NM_001282458.1		Intron			NP_001269387.1
NM_001282459.1		Intron			NP_001269388.1

Gene: EHMT2
Gene Name: euchromatic histone lysine methyltransferase 2

There are no transcripts associated with this gene.

Gene: ZBTB12
Gene Name: zinc finger and BTB domain containing 12

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_181842.2		Intron			NP_862825.1
XM_011514383.2		Intron			XP_011512685.2

View Full Product Details