Product Details

SNP ID: rs11605583
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:65040960 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGGTGTATCATGGGAGCGGCCCGGG[C/T]TACACGTTAAAAACACTAAGGGGAG
Phenotype: MIM: 602640 MIM: 605964
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ARL2-SNX15 PubMed Links

Gene Details

Gene: ARL2-SNX15
Gene Name: ARL2-SNX15 readthrough (NMD candidate)

There are no transcripts associated with this gene.

Gene: NAALADL1
Gene Name: N-acetylated alpha-linked acidic dipeptidase-like 1

There are no transcripts associated with this gene.

Gene: SAC3D1
Gene Name: SAC3 domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_013299.3	57	UTR 5			NP_037431.3

Gene: SNX15
Gene Name: sorting nexin 15

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_013306.4	57	Intron			NP_037438.2
NM_147777.3	57	Intron			NP_680086.2

View Full Product Details