Product Details

SNP ID: rs4074838
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:100435042 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGAATAAGTGATGCAGAGAACAATC[A/G]CTACCTGATCAAAAACAGGCAGTAG
Phenotype: MIM: 611478
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MEPCE PubMed Links

Gene Details

Gene: MEPCE
Gene Name: methylphosphate capping enzyme

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001194990.1		Intron			NP_001181919.1
NM_001194991.1		Intron			NP_001181920.1
NM_001194992.1		Intron			NP_001181921.1
NM_019606.5		Intron			NP_062552.2
XM_011516410.2		Intron			XP_011514712.1

Gene: PPP1R35
Gene Name: protein phosphatase 1 regulatory subunit 35

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_145030.2		Intron			NP_659467.1
XM_011515914.1		Intron			XP_011514216.1

Gene: ZCWPW1
Gene Name: zinc finger CW-type and PWWP domain containing 1

There are no transcripts associated with this gene.

View Full Product Details