Product Details

SNP ID: rs2071914
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:399554 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGGTGTGTCTTTCCCCCCAGCAAAG[C/G]GAGGGGCCCTGGATTGAGCCCAGGG
Phenotype: MIM: 615839 MIM: 601818
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: DECR2 PubMed Links

Gene Details

Gene: DECR2
Gene Name: 2,4-dienoyl-CoA reductase 2, peroxisomal

There are no transcripts associated with this gene.

Gene: LOC100134368
Gene Name: uncharacterized LOC100134368

There are no transcripts associated with this gene.

Gene: NME4
Gene Name: NME/NM23 nucleoside diphosphate kinase 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286433.1		Intron			NP_001273362.1
NM_001286435.1		Intron			NP_001273364.1
NM_001286436.1		Intron			NP_001273365.1
NM_001286438.1		Intron			NP_001273367.1
NM_001286439.1		Intron			NP_001273368.1
NM_001286440.1		Intron			NP_001273369.1
NM_005009.2		Intron			NP_005000.1

View Full Product Details