Product Details

SNP ID
rs3184982
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.4:184694614 on Build GRCh38
Set Membership
HapMap
Context Sequence [VIC/FAM]
CATCACCTAGCAGGCTGTCAACAGG[G/T]GCATCTGCTGATGCTGTCTGGGATA
Phenotype
MIM: 611511 MIM: 615421
Polymorphism
G/T, Transversion Substitution
Allele Nomenclature
Literature Links
CENPU PubMed Links
Additional Information
For this assay, SNP(s) [rs145762735] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
CENPU
Gene Name
centromere protein U
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_024629.3 2001 UTR 3 NP_078905.2
XM_005263218.4 2001 UTR 3 XP_005263275.2
Gene
PRIMPOL
Gene Name
primase and DNA directed polymerase
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001300767.1 2001 Silent Mutation GGG,GGT G377G NP_001287696.1
NM_001300768.1 2001 Silent Mutation GGG,GGT G505G NP_001287697.1
NM_152683.3 2001 Silent Mutation GGG,GGT G506G NP_689896.1
XM_011531719.1 2001 Silent Mutation GGG,GGT G519G XP_011530021.1
XM_011531720.1 2001 Silent Mutation GGG,GGT G519G XP_011530022.1
XM_011531721.2 2001 Silent Mutation GGG,GGT G518G XP_011530023.1
XM_011531723.1 2001 Silent Mutation GGG,GGT G390G XP_011530025.1
XM_011531724.2 2001 Silent Mutation GGG,GGT G344G XP_011530026.1
XM_011531725.1 2001 Silent Mutation GGG,GGT G344G XP_011530027.1
XM_011531726.2 2001 Silent Mutation GGG,GGT G344G XP_011530028.1
XM_011531729.1 2001 Silent Mutation GGG,GGT G287G XP_011530031.1
XM_011531730.2 2001 Silent Mutation GGG,GGT G287G XP_011530032.1
XM_017007864.1 2001 Silent Mutation GGG,GGT G518G XP_016863353.1
XM_017007865.1 2001 Silent Mutation GGG,GGT G506G XP_016863354.1
XM_017007866.1 2001 Silent Mutation GGG,GGT G505G XP_016863355.1
XM_017007867.1 2001 UTR 3 XP_016863356.1
XM_017007868.1 2001 UTR 3 XP_016863357.1
XM_017007869.1 2001 Silent Mutation GGG,GGT G435G XP_016863358.1
XM_017007870.1 2001 Silent Mutation GGG,GGT G422G XP_016863359.1
XM_017007871.1 2001 Silent Mutation GGG,GGT G331G XP_016863360.1
XM_017007872.1 2001 Silent Mutation GGG,GGT G287G XP_016863361.1
XM_017007873.1 2001 Silent Mutation GGG,GGT G274G XP_016863362.1
XM_017007874.1 2001 Silent Mutation GGG,GGT G274G XP_016863363.1
XM_017007875.1 2001 Silent Mutation GGG,GGT G273G XP_016863364.1

View Full Product Details