Product Details

SNP ID: rs3754293
Assay Type: Functionally tested
NCBI dbSNP Submissions: 52
Location: Chr.1:156054582 on Build GRCh38
Set Membership: HapMap JSNP
Context Sequence [VIC/FAM]: ATTCCTTTCTCCCCGAAGGGGTTAA[A/G]TGTCCTTCCAGCGCTGCTGCTGTCC
Phenotype: MIM: 610389 MIM: 612942 MIM: 605440
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LAMTOR2 PubMed Links

Gene Details

Gene: LAMTOR2
Gene Name: late endosomal/lysosomal adaptor, MAPK and MTOR activator 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145264.1		Intron			NP_001138736.1
NM_014017.3		Intron			NP_054736.1

Gene: RAB25
Gene Name: RAB25, member RAS oncogene family

There are no transcripts associated with this gene.

Gene: UBQLN4
Gene Name: ubiquilin 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001304342.1		Intron			NP_001291271.1
NM_020131.4		Intron			NP_064516.2
XM_005245348.3		Intron			XP_005245405.1

View Full Product Details