Product Details

SNP ID: rs3763297
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:31729889 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGTTCCGGGGCGCTGGCACTACTC[C/G]CGGCTCCAGGACCCGGTTCCCCGTC
Phenotype: MIM: 606520 MIM: 602872 MIM: 604744 MIM: 610435
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: C6orf25 PubMed Links

Gene Details

Gene: C6orf25
Gene Name: chromosome 6 open reading frame 25

There are no transcripts associated with this gene.

Gene: CLIC1
Gene Name: chloride intracellular channel 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001287593.1	377	Intron			NP_001274522.1
NM_001287594.1	377	Intron			NP_001274523.1
NM_001288.4	377	Intron			NP_001279.2

Gene: DDAH2
Gene Name: dimethylarginine dimethylaminohydrolase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001303007.1	377	UTR 5			NP_001289936.1
NM_001303008.1	377	Intron			NP_001289937.1
NM_013974.2	377	Intron			NP_039268.1
XM_011514448.2	377	UTR 5			XP_011512750.1

Gene: LY6G6C
Gene Name: lymphocyte antigen 6 complex, locus G6C

There are no transcripts associated with this gene.

View Full Product Details