Product Details

SNP ID
rs3809567
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.15:63042321 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
GCACAGGGGGGCGACGCGCATCCAC[A/C]ACCTGGTCCGCGCTCTCCCGGCCTC
Phenotype
MIM: 191010
Polymorphism
A/C, Transversion Substitution
Allele Nomenclature
Literature Links
TPM1 PubMed Links
Additional Information
For this assay, SNP(s) [rs116461803] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
TPM1
Gene Name
tropomyosin 1 (alpha)
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_000366.5 126 Intron NP_000357.3
NM_001018004.1 126 Intron NP_001018004.1
NM_001018005.1 126 Intron NP_001018005.1
NM_001018006.1 126 Intron NP_001018006.1
NM_001018007.1 126 Intron NP_001018007.1
NM_001018008.1 126 Intron NP_001018008.1
NM_001018020.1 126 Intron NP_001018020.1
NM_001301244.1 126 Intron NP_001288173.1
NM_001301289.1 126 Intron NP_001288218.1
XM_005254637.1 126 Intron XP_005254694.1
XM_005254638.3 126 UTR 5 XP_005254695.2
XM_005254639.3 126 UTR 5 XP_005254696.2
XM_005254645.2 126 UTR 5 XP_005254702.2
XM_005254646.2 126 Intron XP_005254703.1
XM_005254647.3 126 Intron XP_005254704.1
XM_005254650.3 126 Intron XP_005254707.1
XM_005254651.1 126 Intron XP_005254708.1
XM_005254652.1 126 Intron XP_005254709.1
XM_005254653.2 126 Intron XP_005254710.1
XM_006720667.3 126 UTR 5 XP_006720730.2
XM_017022534.1 126 UTR 5 XP_016878023.1
XM_017022535.1 126 Intron XP_016878024.1
XM_017022536.1 126 UTR 5 XP_016878025.1
XM_017022537.1 126 Intron XP_016878026.1
XM_017022538.1 126 UTR 5 XP_016878027.1
XM_017022539.1 126 UTR 5 XP_016878028.1
XM_017022540.1 126 Intron XP_016878029.1
XM_017022541.1 126 Intron XP_016878030.1

View Full Product Details