Product Details

SNP ID: rs3732847
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:159273764 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GACCCTTTACGGATTTCTTTCAAAG[C/G]CAATTTGAATAAACAACTCTTCCCT
Phenotype: MIM: 611622
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: IQCJ PubMed Links

Gene Details

Gene: IQCJ
Gene Name: IQ motif containing J

There are no transcripts associated with this gene.

Gene: IQCJ-SCHIP1
Gene Name: IQCJ-SCHIP1 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001197113.1	518	Intron			NP_001184042.1
NM_001197114.1	518	Intron			NP_001184043.1

Gene: MIR3919
Gene Name: microRNA 3919

There are no transcripts associated with this gene.

Gene: SCHIP1
Gene Name: schwannomin interacting protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001197107.1	518	UTR 5			NP_001184036.1
NM_001197108.1	518	UTR 5			NP_001184037.1
NM_001197109.1	518	Intron			NP_001184038.1
NM_014575.3	518	UTR 5			NP_055390.1

View Full Product Details