Product Details

SNP ID: rs3747444
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:149541156 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCTTGCTTGGGAGCCCATCGTCCTG[G/T]CTCCGGTGGCCTCGCTGGGTCTCGG
Phenotype: MIM: 300954
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: CXorf40A PubMed Links

Gene Details

Gene: CXorf40A
Gene Name: chromosome X open reading frame 40A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001171907.2	183	Intron			NP_001165378.1
NM_001171908.2	183	Intron			NP_001165379.1
NM_001171909.3	183	Intron			NP_001165380.1
NM_001324274.1	183	Intron			NP_001311203.1
NM_001324275.1	183	Intron			NP_001311204.1
NM_001324276.1	183	UTR 5			NP_001311205.1
NM_001324277.1	183	Intron			NP_001311206.1
NM_001324278.1	183	Intron			NP_001311207.1
NM_001324279.1	183	UTR 5			NP_001311208.1
NM_001324280.1	183	Intron			NP_001311209.1
NM_178124.5	183	Intron			NP_835225.2
XM_005262349.4	183	Intron			XP_005262406.2

Gene: LINC00893
Gene Name: long intergenic non-protein coding RNA 893

There are no transcripts associated with this gene.

Gene: LOC101928917
Gene Name: heat shock transcription factor, X-linked-like

There are no transcripts associated with this gene.

View Full Product Details