Product Details

SNP ID: rs72791208
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:30024485 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGTAAAGCACCTCCCAGGGTCCCC[T/C]GACCCCAGATTGGAGGAAGCCTTGA
Phenotype: MIM: 604567 MIM: 615175
Polymorphism: T/C, Transition substitution
Allele Nomenclature
Literature Links: C16orf92 PubMed Links

Gene Details

Gene: C16orf92
Gene Name: chromosome 16 open reading frame 92

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001109659.1	598	UTR 3			NP_001103129.1
NM_001109660.1	598	UTR 3			NP_001103130.1

Gene: DOC2A
Gene Name: double C2 domain alpha

There are no transcripts associated with this gene.

Gene: FAM57B
Gene Name: family with sequence similarity 57 member B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318504.1	598	UTR 3			NP_001305433.1
NM_031478.5	598	UTR 3			NP_113666.2
XM_005255613.3	598	UTR 3			XP_005255670.1
XM_005255614.3	598	UTR 3			XP_005255671.1
XM_005255615.2	598	UTR 3			XP_005255672.1
XM_017023749.1	598	UTR 3			XP_016879238.1
XM_017023750.1	598	UTR 3			XP_016879239.1
XM_017023751.1	598	UTR 3			XP_016879240.1
XM_017023752.1	598	UTR 3			XP_016879241.1
XM_017023753.1	598	UTR 3			XP_016879242.1
XM_017023754.1	598	UTR 3			XP_016879243.1

View Full Product Details