Product Details

SNP ID: rs4660233
Assay Type: Functionally tested
NCBI dbSNP Submissions: 52
Location: Chr.1:42848230 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GAGTGGAGGCTGAATAGCTCATTGC[A/G]TAGAGATACTGTAGCTGTAGGTCAG
Phenotype: MIM: 609017
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ERMAP PubMed Links

Gene Details

Gene: ERMAP
Gene Name: erythroblast membrane associated protein (Scianna blood group)

There are no transcripts associated with this gene.

Gene: LOC339539
Gene Name: uncharacterized LOC339539

There are no transcripts associated with this gene.

Gene: ZNF691
Gene Name: zinc finger protein 691

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242739.1	1555	Intron			NP_001229668.1
NM_015911.3	1555	Intron			NP_056995.1
XM_006710671.3	1555	Intron			XP_006710734.1
XM_017001400.1	1555	Intron			XP_016856889.1
XM_017001401.1	1555	UTR 5			XP_016856890.1
XM_017001402.1	1555	Intron			XP_016856891.1
XM_017001403.1	1555	UTR 5			XP_016856892.1

View Full Product Details