Product Details

SNP ID: rs4889605
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:30989774 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ACGCTCAGGGCGTGGCAAGAGCGTG[C/T]GTCGACCCACGGGTACATGGGATGG
Phenotype: MIM: 607764 MIM: 611052 MIM: 601485
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: HSD3B7 PubMed Links

Gene Details

Gene: HSD3B7
Gene Name: hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001142777.1	4156	Intron			NP_001136249.1
NM_001142778.1	4156	Intron			NP_001136250.1
NM_025193.3	4156	Intron			NP_079469.2
XM_005255601.3	4156	Intron			XP_005255658.2
XM_011545960.2	4156	Intron			XP_011544262.1
XM_011545961.1	4156	Intron			XP_011544263.1
XM_011545962.2	4156	Intron			XP_011544264.1
XM_017023732.1	4156	Intron			XP_016879221.1

Gene: SETD1A
Gene Name: SET domain containing 1A

There are no transcripts associated with this gene.

Gene: STX1B
Gene Name: syntaxin 1B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_052874.4	4156	UTR 3			NP_443106.1
XM_017022893.1	4156	UTR 3			XP_016878382.1

View Full Product Details