Product Details

SNP ID: rs8056985
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:2523814 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TGTCCAGCCTCTTCTCTGTCCCCAG[C/G]CACATTCCCCACTCCTGCCCCCAAA
Phenotype: MIM: 108745 MIM: 611113
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: AMDHD2 PubMed Links

Gene Details

Gene: AMDHD2
Gene Name: amidohydrolase domain containing 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145815.1		Intron			NP_001139287.1
NM_015944.3		Intron			NP_057028.2
XM_017023262.1		Intron			XP_016878751.1
XM_017023263.1		Intron			XP_016878752.1
XM_017023264.1		Intron			XP_016878753.1
XM_017023265.1		Intron			XP_016878754.1
XM_017023266.1		Intron			XP_016878755.1
XM_017023267.1		Intron			XP_016878756.1

Gene: ATP6V0C
Gene Name: ATPase H+ transporting V0 subunit c

There are no transcripts associated with this gene.

Gene: CEMP1
Gene Name: cementum protein 1

There are no transcripts associated with this gene.

Gene: MIR3178
Gene Name: microRNA 3178

There are no transcripts associated with this gene.

View Full Product Details