Product Details

SNP ID: rs8017976
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:101046261 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAGCGGGAAGTCATCAGCCCGGGCC[A/G]ATGGCTGGGGTGGCGCTCGTGTGGG
Phenotype: MIM: 610164 MIM: 610959 MIM: 610960 MIM: 610961 MIM: 610983 MIM: 615385 MIM: 615037
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MIR1185-1 PubMed Links

Gene Details

Gene: MIR1185-1
Gene Name: microRNA 1185-1

There are no transcripts associated with this gene.

Gene: MIR1185-2
Gene Name: microRNA 1185-2

There are no transcripts associated with this gene.

Gene: MIR134
Gene Name: microRNA 134

There are no transcripts associated with this gene.

Gene: MIR300
Gene Name: microRNA 300

There are no transcripts associated with this gene.

Gene: MIR323B
Gene Name: microRNA 323b

There are no transcripts associated with this gene.

Gene: MIR376A1
Gene Name: microRNA 376a-1

There are no transcripts associated with this gene.

Gene: MIR376A2
Gene Name: microRNA 376a-2

There are no transcripts associated with this gene.

Gene: MIR376B
Gene Name: microRNA 376b

There are no transcripts associated with this gene.

Gene: MIR376C
Gene Name: microRNA 376c

There are no transcripts associated with this gene.

Gene: MIR381
Gene Name: microRNA 381

There are no transcripts associated with this gene.

Gene: MIR381HG
Gene Name: MIR381 host gene

There are no transcripts associated with this gene.

Gene: MIR382
Gene Name: microRNA 382

There are no transcripts associated with this gene.

Gene: MIR485
Gene Name: microRNA 485

There are no transcripts associated with this gene.

Gene: MIR487A
Gene Name: microRNA 487a

There are no transcripts associated with this gene.

Gene: MIR487B
Gene Name: microRNA 487b

There are no transcripts associated with this gene.

Gene: MIR539
Gene Name: microRNA 539

There are no transcripts associated with this gene.

Gene: MIR544A
Gene Name: microRNA 544a

There are no transcripts associated with this gene.

Gene: MIR654
Gene Name: microRNA 654

There are no transcripts associated with this gene.

Gene: MIR655
Gene Name: microRNA 655

There are no transcripts associated with this gene.

Gene: MIR668
Gene Name: microRNA 668

There are no transcripts associated with this gene.

Gene: MIR889
Gene Name: microRNA 889

There are no transcripts associated with this gene.

View Full Product Details