Product Details

SNP ID: rs6670355
Assay Type: Functionally tested
NCBI dbSNP Submissions: 16
Location: Chr.1:156737583 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATGGGTGGGAGGGCTTGCCAACTTT[C/T]ATTAATGTCCCCTACTCTCACTCCT
Phenotype: MIM: 600339 MIM: 611930 MIM: 611836
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: HDGF PubMed Links

Gene Details

Gene: HDGF
Gene Name: hepatoma-derived growth factor

There are no transcripts associated with this gene.

Gene: ISG20L2
Gene Name: interferon stimulated exonuclease gene 20 like 2

There are no transcripts associated with this gene.

Gene: MRPL24
Gene Name: mitochondrial ribosomal protein L24

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024540.3		Intron			NP_078816.2
NM_145729.2		Intron			NP_663781.1
XM_011509981.2		Intron			XP_011508283.1
XM_011509982.2		Intron			XP_011508284.1

Gene: RRNAD1
Gene Name: ribosomal RNA adenine dimethylase domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001142560.1		Intron			NP_001136032.1
NM_015997.3		Intron			NP_057081.3
XM_005245234.4		Intron			XP_005245291.1
XM_005245235.4		Intron			XP_005245292.1
XM_005245236.4		Intron			XP_005245293.1
XM_005245237.4		Intron			XP_005245294.1
XM_011509600.1		Intron			XP_011507902.1
XM_017001404.1		Intron			XP_016856893.1
XM_017001405.1		Intron			XP_016856894.1
XM_017001406.1		Intron			XP_016856895.1

View Full Product Details