Product Details

SNP ID: rs8065028
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:48725173 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGAGGACGTGGAAGGCAGAAAGTG[A/G]CCTGCTCTGAGCGGCGCATGTAACC
Phenotype: MIM: 604607 MIM: 609819 MIM: 610787
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: HOXB13 PubMed Links

Gene Details

Gene: HOXB13
Gene Name: homeobox B13

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006361.5	2628	UTR 3			NP_006352.2

Gene: MIR3185
Gene Name: microRNA 3185

There are no transcripts associated with this gene.

Gene: PRAC1
Gene Name: prostate cancer susceptibility candidate 1

There are no transcripts associated with this gene.

Gene: PRAC2
Gene Name: prostate cancer susceptibility candidate 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001282275.1	2628	Intron			NP_001269204.1
NM_001282276.1	2628	Intron			NP_001269205.1
XM_006721865.3	2628	Intron			XP_006721928.1
XM_011524747.2	2628	Intron			XP_011523049.1
XM_011524748.1	2628	Intron			XP_011523050.1

View Full Product Details