Product Details

SNP ID: rs9948906
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.18:21826269 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCCACTGCTTCTTTTAGCATTATAG[C/T]TGAGGGCTAATAGCAAATTGTTGAT
Phenotype: MIM: 608677 MIM: 610252 MIM: 610254
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MIB1 PubMed Links

Gene Details

Gene: MIB1
Gene Name: mindbomb E3 ubiquitin protein ligase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_020774.3		Intron			NP_065825.1
XM_011526098.1		Intron			XP_011524400.1
XM_017025873.1		Intron			XP_016881362.1
XM_017025874.1		Intron			XP_016881363.1
XM_017025875.1		Intron			XP_016881364.1

Gene: MIR1-2
Gene Name: microRNA 1-2

There are no transcripts associated with this gene.

Gene: MIR133A1
Gene Name: microRNA 133a-1

There are no transcripts associated with this gene.

Gene: MIR133A1HG
Gene Name: MIR133A1 host gene

There are no transcripts associated with this gene.

View Full Product Details