Product Details

SNP ID: rs9646863
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:219504498 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCCAGAGACGTCTTTCAGAACAGAC[A/G]GCAACACACAGTTGGGCGCACACAT
Phenotype: MIM: 606715 MIM: 615495
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ASIC4 PubMed Links

Gene Details

Gene: ASIC4
Gene Name: acid sensing ion channel subunit family member 4

There are no transcripts associated with this gene.

Gene: GMPPA
Gene Name: GDP-mannose pyrophosphorylase A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_013335.3		Intron			NP_037467.2
NM_205847.2		Intron			NP_995319.1
XM_005246483.3		Intron			XP_005246540.1
XM_005246486.3		Intron			XP_005246543.1
XM_011511032.2		Intron			XP_011509334.1
XM_017003906.1		Intron			XP_016859395.1
XM_017003907.1		Intron			XP_016859396.1
XM_017003908.1		Intron			XP_016859397.1
XM_017003909.1		Intron			XP_016859398.1
XM_017003910.1		Intron			XP_016859399.1
XM_017003911.1		Intron			XP_016859400.1
XM_017003912.1		Intron			XP_016859401.1
XM_017003913.1		Intron			XP_016859402.1
XM_017003914.1		Intron			XP_016859403.1
XM_017003915.1		Intron			XP_016859404.1
XM_017003916.1		Intron			XP_016859405.1
XM_017003917.1		Intron			XP_016859406.1

Gene: LOC100996693
Gene Name: CAVP-target protein-like

There are no transcripts associated with this gene.

View Full Product Details