Product Details

SNP ID
rs6122753
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.20:49114721 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
AGTCCAGCCCGGCCACAGCCGCCTC[C/T]TTGTGTTTCTGTTGTCTTCCCTGCT
Phenotype
MIM: 601716
Polymorphism
C/T, Transition Substitution
Allele Nomenclature
Literature Links
STAU1 PubMed Links
Additional Information
For this assay, SNP(s) [rs1043357] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
STAU1
Gene Name
staufen double-stranded RNA binding protein 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001037328.2 1959 UTR 3 NP_001032405.1
NM_001319134.1 1959 UTR 3 NP_001306063.1
NM_001319135.1 1959 UTR 3 NP_001306064.1
NM_001322927.1 1959 UTR 3 NP_001309856.1
NM_001322928.1 1959 UTR 3 NP_001309857.1
NM_001322929.1 1959 UTR 3 NP_001309858.1
NM_001322930.1 1959 UTR 3 NP_001309859.1
NM_001322931.1 1959 UTR 3 NP_001309860.1
NM_001322932.1 1959 UTR 3 NP_001309861.1
NM_001322933.1 1959 UTR 3 NP_001309862.1
NM_004602.3 1959 UTR 3 NP_004593.2
NM_017452.3 1959 UTR 3 NP_059346.2
NM_017453.3 1959 UTR 3 NP_059347.2
NM_017454.3 1959 UTR 3 NP_059348.2
XM_005260527.1 1959 UTR 3 XP_005260584.1
XM_006723865.1 1959 UTR 3 XP_006723928.1
XM_011529015.1 1959 UTR 3 XP_011527317.1
XM_017028028.1 1959 UTR 3 XP_016883517.1

View Full Product Details