Product Details

SNP ID: rs9771743
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:143575631 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCGACACTGTCCCTACCTTATAGAC[A/G]CCACCCAGGGAAGGCTGTTGGGGGC
Phenotype: MIM: 130592 MIM: 611552
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: EEF1D PubMed Links

Gene Details

Gene: EEF1D
Gene Name: eukaryotic translation elongation factor 1 delta

There are no transcripts associated with this gene.

Gene: MROH6
Gene Name: maestro heat like repeat family member 6

There are no transcripts associated with this gene.

Gene: NAPRT
Gene Name: nicotinate phosphoribosyltransferase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286829.1	1075	Silent Mutation	GGC,GGT	G393G	NP_001273758.1
NM_145201.5	1075	Silent Mutation	GGC,GGT	G393G	NP_660202.3
XM_017013975.1	1075	Silent Mutation	GGC,GGT	G466G	XP_016869464.1
XM_017013976.1	1075	Silent Mutation	GGC,GGT	G466G	XP_016869465.1
XM_017013977.1	1075	Intron			XP_016869466.1
XM_017013978.1	1075	Silent Mutation	GGC,GGT	G466G	XP_016869467.1
XM_017013979.1	1075	Silent Mutation	GGC,GGT	G165G	XP_016869468.1
XM_017013980.1	1075	Silent Mutation	GGC,GGT	G165G	XP_016869469.1

View Full Product Details