Product Details

SNP ID: rs10082591
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:125595690 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTCCATTTTAGTCTTGACACATAGA[C/T]CTGACTTGTGCCTACTTCCTTGCAA
Phenotype: MIM: 601134
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: STT3A PubMed Links

Gene Details

Gene: STT3A
Gene Name: STT3A, catalytic subunit of the oligosaccharyltransferase complex

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001278503.1		Intron			NP_001265432.1
NM_001278504.1		Intron			NP_001265433.1
NM_152713.4		Intron			NP_689926.1
XM_011542807.2		Intron			XP_011541109.1

Gene: STT3A-AS1
Gene Name: STT3A antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details