Product Details

SNP ID: rs10401035
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.17:75181601 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ACTGCAAGAAACAAAACAATAAATC[A/T]ACAGCCTGCCATTCAAAACTCATTA
Phenotype: MIM: 603042
Polymorphism: A/T, Transversion Substitution
Allele Nomenclature
Literature Links: SUMO2 PubMed Links
Additional Information: For this assay, SNP(s) [rs115718157] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001005849.1		Intron			NP_001005849.1
NM_006937.3		Intron			NP_008868.3