Product Details

SNP ID: rs10447099
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.5:62417350 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTTTTTTTTTTTTTTTTTTTTTTGG[G/T]ATTTTGAAGGCTGACAGTCCATAGC
Phenotype: MIM: 610889
Polymorphism: G/T, Transversion Substitution
Allele Nomenclature
Literature Links: IPO11 PubMed Links
Additional Information: For this assay, SNP(s) [rs76466551] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001134779.1		Intron			NP_001128251.1
NM_016338.4		Intron			NP_057422.3