Product Details

SNP ID: rs9896695
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:7254798 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CATGCTGTGAGCCATCAGGACTCTT[C/G]TCCTGGTGAGACCCCTCCTTCATTG
Phenotype: MIM: 609131 MIM: 610684 MIM: 615019
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: CLDN7 PubMed Links

Gene Details

Gene: CLDN7
Gene Name: claudin 7

There are no transcripts associated with this gene.

Gene: CTDNEP1
Gene Name: CTD nuclear envelope phosphatase 1

There are no transcripts associated with this gene.

Gene: ELP5
Gene Name: elongator acetyltransferase complex subunit 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_015362.4	666	Missense Mutation	TCT,TGT	S151C	NP_056177.3
NM_203413.2	666	Missense Mutation	TCT,TGT	S151C	NP_981958.1
NM_203414.2	666	Missense Mutation	TCT,TGT	S151C	NP_981959.1
NM_203415.1	666	Missense Mutation	TCT,TGT	S151C	NP_981960.1
XM_011523779.2	666	Missense Mutation	TCT,TGT	S151C	XP_011522081.1

View Full Product Details