Product Details

SNP ID: rs9946054
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.18:2662792 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AATCTATAAGGTCATTTTTGTCTCT[G/T]TTAAACAAATAGAATCTTCCCAGTC
Phenotype: MIM: 614982
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: CBX3P2 PubMed Links

Gene Details

Gene: CBX3P2
Gene Name: chromobox 3 pseudogene 2

There are no transcripts associated with this gene.

Gene: SMCHD1
Gene Name: structural maintenance of chromosomes flexible hinge domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_015295.2		Intron			NP_056110.2
XM_011525642.1		Intron			XP_011523944.1
XM_011525643.2		Intron			XP_011523945.1
XM_011525644.2		Intron			XP_011523946.1
XM_017025684.1		Intron			XP_016881173.1

View Full Product Details