Product Details

SNP ID: rs12270967
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:57326467 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGGGGGAGTACTGGCTAGTTCTTC[C/T]TCTTCAGAGTCCTGAAAACCAAAGG
Phenotype: MIM: 600843 MIM: 604328 MIM: 607104
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: P2RX3 PubMed Links

Gene Details

Gene: P2RX3
Gene Name: purinergic receptor P2X 3

There are no transcripts associated with this gene.

Gene: SSRP1
Gene Name: structure specific recognition protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003146.2	2554	Silent Mutation	GAA,GAG	E690E	NP_003137.1
XM_017018180.1	2554	Silent Mutation	GAA,GAG	E824E	XP_016873669.1
XM_017018181.1	2554	Intron			XP_016873670.1

Gene: TNKS1BP1
Gene Name: tankyrase 1 binding protein 1

There are no transcripts associated with this gene.

View Full Product Details