Product Details

SNP ID: rs13053363
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.22:50530969 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGTCCTCGAAGAAACTGCCAGCCG[C/T]TCTGCGGCCGTAGATGGAGCAAGTT
Phenotype: MIM: 611230 MIM: 604272 MIM: 131222
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: NCAPH2 PubMed Links

Gene Details

Gene: NCAPH2
Gene Name: non-SMC condensin II complex subunit H2

There are no transcripts associated with this gene.

Gene: ODF3B
Gene Name: outer dense fiber of sperm tails 3B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001014440.3	645	Missense Mutation	ACG,GCG	T170A	NP_001014440.2

Gene: SCO2
Gene Name: SCO2 cytochrome c oxidase assembly protein

There are no transcripts associated with this gene.

Gene: TYMP
Gene Name: thymidine phosphorylase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001113755.2	645	Intron			NP_001107227.1
NM_001113756.2	645	Intron			NP_001107228.1
NM_001257988.1	645	Intron			NP_001244917.1
NM_001257989.1	645	Intron			NP_001244918.1
NM_001953.4	645	Intron			NP_001944.1

View Full Product Details