Product Details

SNP ID: rs6432519
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:159236638 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATTTACTCCCCTAAGGATTTGACAG[C/T]GAAGGGACTTAGGTTTTTTTGTTTG
Phenotype: MIM: 611397
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: TANC1 PubMed Links

Gene Details

Gene: TANC1
Gene Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1

There are no transcripts associated with this gene.

Gene: WDSUB1
Gene Name: WD repeat, sterile alpha motif and U-box domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001128212.2		Intron			NP_001121684.1
NM_001128213.1		Intron			NP_001121685.1
NM_001307994.1		Intron			NP_001294923.1
NM_152528.2		Intron			NP_689741.2
XM_005246355.2		Intron			XP_005246412.2
XM_006712341.3		Intron			XP_006712404.1
XM_011510753.2		Intron			XP_011509055.1
XM_011510754.2		Intron			XP_011509056.1
XM_017003481.1		Intron			XP_016858970.1
XM_017003482.1		Intron			XP_016858971.1
XM_017003483.1		Intron			XP_016858972.1

View Full Product Details