Product Details

SNP ID: rs11892277
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:74420541 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AAGTCTTGCAGAACTCAAAATCCCT[G/T]AAGTCTCATTAACCCTATCCACCAG
Phenotype: MIM: 602288
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: C2orf81 PubMed Links

Gene Details

Gene: C2orf81
Gene Name: chromosome 2 open reading frame 81

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145054.1		Intron			NP_001138526.1
NM_001316764.1		Intron			NP_001303693.1
NM_001316765.1		Intron			NP_001303694.1
NM_001316766.1		Intron			NP_001303695.1

Gene: RTKN
Gene Name: rhotekin

There are no transcripts associated with this gene.

Gene: WDR54
Gene Name: WD repeat domain 54

There are no transcripts associated with this gene.

View Full Product Details