Product Details

SNP ID
rs13377225
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.11:47472989 on Build GRCh38
Set Membership
HapMap
Context Sequence [VIC/FAM]
ACCTGCCCATGGCCAAGTTAAAACA[A/C]CACCACAAACTCATATTCAGATCTT
Phenotype
MIM: 601074
Polymorphism
A/C, Transversion Substitution
Allele Nomenclature
Literature Links
CELF1 PubMed Links
Additional Information
For this assay, SNP(s) [rs78168876] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
CELF1
Gene Name
CUGBP, Elav-like family member 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001025596.2 Intron NP_001020767.1
NM_001172639.1 Intron NP_001166110.1
NM_001172640.1 Intron NP_001166111.1
NM_006560.3 Intron NP_006551.1
NM_198700.2 Intron NP_941989.1
XM_011519848.2 Intron XP_011518150.1
XM_011519850.2 Intron XP_011518152.2
XM_011519852.2 Intron XP_011518154.1
XM_011519854.1 Intron XP_011518156.1
XM_011519855.1 Intron XP_011518157.1
XM_011519856.1 Intron XP_011518158.1
XM_011519857.1 Intron XP_011518159.1
XM_011519858.1 Intron XP_011518160.1
XM_011519859.1 Intron XP_011518161.1
XM_017017101.1 Intron XP_016872590.1
XM_017017102.1 Intron XP_016872591.1
XM_017017103.1 Intron XP_016872592.1
XM_017017104.1 Intron XP_016872593.1
XM_017017105.1 Intron XP_016872594.1
XM_017017106.1 Intron XP_016872595.1
XM_017017107.1 Intron XP_016872596.1
XM_017017108.1 Intron XP_016872597.1
XM_017017109.1 Intron XP_016872598.1
XM_017017110.1 Intron XP_016872599.1
XM_017017111.1 Intron XP_016872600.1
XM_017017112.1 Intron XP_016872601.1
XM_017017113.1 Intron XP_016872602.1
XM_017017114.1 Intron XP_016872603.1
XM_017017115.1 Intron XP_016872604.1
XM_017017116.1 Intron XP_016872605.1
XM_017017117.1 Intron XP_016872606.1
XM_017017118.1 Intron XP_016872607.1
XM_017017119.1 Intron XP_016872608.1
XM_017017120.1 Intron XP_016872609.1
XM_017017121.1 Intron XP_016872610.1
XM_017017122.1 Intron XP_016872611.1
XM_017017123.1 Intron XP_016872612.1
XM_017017124.1 Intron XP_016872613.1
XM_017017125.1 Intron XP_016872614.1
XM_017017126.1 Intron XP_016872615.1
XM_017017127.1 Intron XP_016872616.1
XM_017017128.1 Intron XP_016872617.1
XM_017017129.1 Intron XP_016872618.1
XM_017017130.1 Intron XP_016872619.1
XM_017017131.1 Intron XP_016872620.1
XM_017017132.1 Intron XP_016872621.1
XM_017017133.1 Intron XP_016872622.1
XM_017017134.1 Intron XP_016872623.1
XM_017017135.1 Intron XP_016872624.1

View Full Product Details