Product Details

SNP ID

rs11804508

Assay Type

Functionally tested

NCBI dbSNP Submissions

43

Location

Chr.1:228211781 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CTACTTGCAGGTCCCCGCCGCCACC[C/G]TCATGGATCAGCCACAGTTCAGCGG

Phenotype

MIM: 608616

Polymorphism

C/G, Transversion substitution

Allele Nomenclature

Literature Links

C1orf145 PubMed Links

Gene Details

Gene

C1orf145

Gene Name

chromosome 1 open reading frame 145

There are no transcripts associated with this gene.

Gene

OBSCN

Gene Name

obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001098623.2	151	UTR 5			NP_001092093.2
NM_001271223.2	151	UTR 5			NP_001258152.2
NM_052843.3	151	UTR 5			NP_443075.3
XM_005273287.4	151	UTR 5			XP_005273344.1
XM_005273291.4	151	UTR 5			XP_005273348.1
XM_005273298.4	151	UTR 5			XP_005273355.1
XM_005273307.4	151	UTR 5			XP_005273364.1
XM_006711822.3	151	UTR 5			XP_006711885.1
XM_006711823.3	151	UTR 5			XP_006711886.1
XM_006711827.3	151	UTR 5			XP_006711890.1
XM_006711829.3	151	UTR 5			XP_006711892.1
XM_011544297.2	151	UTR 5			XP_011542599.1
XM_011544299.2	151	UTR 5			XP_011542601.1
XM_017002443.1	151	UTR 5			XP_016857932.1
XM_017002444.1	151	UTR 5			XP_016857933.1
XM_017002445.1	151	UTR 5			XP_016857934.1
XM_017002446.1	151	UTR 5			XP_016857935.1
XM_017002447.1	151	UTR 5			XP_016857936.1
XM_017002448.1	151	UTR 5			XP_016857937.1
XM_017002449.1	151	UTR 5			XP_016857938.1
XM_017002450.1	151	UTR 5			XP_016857939.1
XM_017002451.1	151	UTR 5			XP_016857940.1
XM_017002452.1	151	UTR 5			XP_016857941.1
XM_017002453.1	151	UTR 5			XP_016857942.1
XM_017002454.1	151	UTR 5			XP_016857943.1
XM_017002455.1	151	UTR 5			XP_016857944.1
XM_017002456.1	151	UTR 5			XP_016857945.1
XM_017002457.1	151	UTR 5			XP_016857946.1
XM_017002458.1	151	UTR 5			XP_016857947.1
XM_017002459.1	151	UTR 5			XP_016857948.1
XM_017002460.1	151	UTR 5			XP_016857949.1
XM_017002461.1	151	UTR 5			XP_016857950.1
XM_017002462.1	151	UTR 5			XP_016857951.1
XM_017002463.1	151	UTR 5			XP_016857952.1
XM_017002464.1	151	UTR 5			XP_016857953.1
XM_017002465.1	151	UTR 5			XP_016857954.1
XM_017002466.1	151	UTR 5			XP_016857955.1
XM_017002467.1	151	UTR 5			XP_016857956.1
XM_017002468.1	151	UTR 5			XP_016857957.1
XM_017002469.1	151	UTR 5			XP_016857958.1
XM_017002470.1	151	UTR 5			XP_016857959.1
XM_017002471.1	151	UTR 5			XP_016857960.1
XM_017002472.1	151	UTR 5			XP_016857961.1
XM_017002473.1	151	UTR 5			XP_016857962.1

View Full Product Details