Product Details

SNP ID

rs12252639

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.10:35128854 on Build GRCh38

Set Membership

HapMap

Context Sequence [VIC/FAM]

TTTCCTAGTCTTGATTCTTTTTTTG[G/T]ATAAACTTTCCCTTCCTAAGTCATA

Phenotype

MIM: 123812 MIM: 603135

Polymorphism

G/T, Transversion Substitution

Allele Nomenclature

Literature Links

CREM PubMed Links

Additional Information

For this assay, SNP(s) [rs114736635] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

CREM

Gene Name

cAMP responsive element modulator

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001267562.1		Intron			NP_001254491.1
NM_001267563.1		Intron			NP_001254492.1
NM_001267564.1		Intron			NP_001254493.1
NM_001267565.1		Intron			NP_001254494.1
NM_001267566.1		Intron			NP_001254495.1
NM_001267567.1		Intron			NP_001254496.1
NM_001267568.1		Intron			NP_001254497.1
NM_001267569.1		Intron			NP_001254498.1
NM_001267570.1		Intron			NP_001254499.1
NM_001881.3		Intron			NP_001872.3
NM_181571.2		Intron			NP_853549.1
NM_182717.1		Intron			NP_874386.1
NM_182718.1		Intron			NP_874387.1
NM_182719.1		Intron			NP_874388.1
NM_182720.1		Intron			NP_874389.1
NM_182721.1		Intron			NP_874390.1
NM_182723.1		Intron			NP_874392.1
NM_182724.1		Intron			NP_874393.1
NM_182769.2		Intron			NP_877570.1
NM_182770.2		Intron			NP_877571.1
NM_182771.1		Intron			NP_877572.1
NM_182772.1		Intron			NP_877573.1
NM_183011.1		Intron			NP_898829.1
NM_183012.1		Intron			NP_898830.1
NM_183013.2		Intron			NP_898831.1
NM_183060.2		Intron			NP_898883.1
XM_006717378.3		Intron			XP_006717441.1
XM_006717379.3		Intron			XP_006717442.1
XM_006717382.3		Intron			XP_006717445.1
XM_006717383.3		Intron			XP_006717446.1
XM_006717387.3		Intron			XP_006717450.1
XM_011519316.2		Intron			XP_011517618.1
XM_011519324.2		Intron			XP_011517626.1
XM_011519325.2		Intron			XP_011517627.1
XM_011519327.2		Intron			XP_011517629.1
XM_011519330.2		Intron			XP_011517632.1
XM_011519331.2		Intron			XP_011517633.1
XM_011519332.2		Intron			XP_011517634.1
XM_011519333.1		Intron			XP_011517635.1
XM_011519335.2		Intron			XP_011517637.1
XM_017015716.1		Intron			XP_016871205.1
XM_017015717.1		Intron			XP_016871206.1
XM_017015718.1		Intron			XP_016871207.1
XM_017015719.1		Intron			XP_016871208.1
XM_017015720.1		Intron			XP_016871209.1
XM_017015721.1		Intron			XP_016871210.1
XM_017015722.1		Intron			XP_016871211.1
XM_017015723.1		Intron			XP_016871212.1
XM_017015724.1		Intron			XP_016871213.1
XM_017015725.1		Intron			XP_016871214.1
XM_017015726.1		Intron			XP_016871215.1
XM_017015727.1		Intron			XP_016871216.1
XM_017015728.1		Intron			XP_016871217.1
XM_017015729.1		Intron			XP_016871218.1
XM_017015730.1		Intron			XP_016871219.1
XM_017015731.1		Intron			XP_016871220.1
XM_017015732.1		Intron			XP_016871221.1
XM_017015733.1		Intron			XP_016871222.1
XM_017015734.1		Intron			XP_016871223.1
XM_017015735.1		Intron			XP_016871224.1
XM_017015736.1		Intron			XP_016871225.1
XM_017015737.1		Intron			XP_016871226.1

Gene

CUL2

Gene Name

cullin 2

There are no transcripts associated with this gene.

View Full Product Details