Product Details

SNP ID: rs11230672
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:61353609 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGGAGGGATAAAAGGAACAGGGTAA[A/G]TTCAGGCCACTGACCTCCCACAGCC
Phenotype: MIM: 615844 MIM: 614459
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CYB561A3 PubMed Links

Gene Details

Gene: CYB561A3
Gene Name: cytochrome b561 family member A3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001161452.1		Intron			NP_001154924.1
NM_001161454.1		Intron			NP_001154926.1
NM_001300763.1		Intron			NP_001287692.1
NM_153611.4		Intron			NP_705839.3
XM_011544821.1		Intron			XP_011543123.1
XM_011544823.1		Intron			XP_011543125.1
XM_011544824.1		Intron			XP_011543126.1
XM_017017345.1		Intron			XP_016872834.1
XM_017017346.1		Intron			XP_016872835.1
XM_017017347.1		Intron			XP_016872836.1

Gene: TKFC
Gene Name: triokinase and FMN cyclase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_015533.3		Intron			NP_056348.2
XM_011544912.2		Intron			XP_011543214.1
XM_017017517.1		Intron			XP_016873006.1
XM_017017518.1		Intron			XP_016873007.1
XM_017017519.1		Intron			XP_016873008.1
XM_017017520.1		Intron			XP_016873009.1
XM_017017521.1		Intron			XP_016873010.1
XM_017017522.1		Intron			XP_016873011.1
XM_017017523.1		Intron			XP_016873012.1
XM_017017524.1		Intron			XP_016873013.1

Gene: TMEM138
Gene Name: transmembrane protein 138

There are no transcripts associated with this gene.

View Full Product Details