Product Details

SNP ID: rs13437725
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:27107283 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTGAACAAAAGGCCCAAGAACCCTT[C/T]TGAACCATCAGGGTACAGAATTCTT
Phenotype: MIM: 604685 MIM: 142954
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: HOTAIRM1 PubMed Links

Gene Details

Gene: HOTAIRM1
Gene Name: HOXA transcript antisense RNA, myeloid-specific 1

There are no transcripts associated with this gene.

Gene: HOXA2
Gene Name: homeobox A2

There are no transcripts associated with this gene.

Gene: HOXA3
Gene Name: homeobox A3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_030661.4	2867	UTR 3			NP_109377.1
NM_153631.2	2867	UTR 3			NP_705895.1
XM_005249730.2	2867	UTR 3			XP_005249787.1
XM_005249731.2	2867	UTR 3			XP_005249788.1
XM_005249732.3	2867	UTR 3			XP_005249789.1
XM_006715715.2	2867	UTR 3			XP_006715778.1
XM_011515343.2	2867	UTR 3			XP_011513645.1

View Full Product Details