Product Details

SNP ID: rs3138361
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:129432295 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ACCACTGGAGATGAGTCAGAGGCCA[C/T]GCCGCTGGACTGGTCTTTGTGGACT
Phenotype: MIM: 606045 MIM: 603574
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: EFCAB12 PubMed Links

Gene Details

Gene: EFCAB12
Gene Name: EF-hand calcium binding domain 12

There are no transcripts associated with this gene.

Gene: IFT122
Gene Name: intraflagellar transport 122

There are no transcripts associated with this gene.

Gene: MBD4
Gene Name: methyl-CpG binding domain 4, DNA glycosylase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001276270.1	2219	Intron			NP_001263199.1
NM_001276271.1	2219	UTR 3			NP_001263200.1
NM_001276272.1	2219	Intron			NP_001263201.1
NM_001276273.1	2219	Intron			NP_001263202.1
NM_003925.2	2219	Intron			NP_003916.1
XM_011513268.2	2219	Intron			XP_011511570.1

View Full Product Details