Product Details

SNP ID: rs4816628
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.21:39451014 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TGTTATTGTTGTTGGTAAAGTCGTA[A/C]CTCAGTATGTTACCCAGACTGGTCT
Phenotype: MIM: 602230
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: LCA5L PubMed Links

Gene Details

Gene: LCA5L
Gene Name: LCA5L, lebercilin like

There are no transcripts associated with this gene.

Gene: MIR6508
Gene Name: microRNA 6508

There are no transcripts associated with this gene.

Gene: SH3BGR
Gene Name: SH3 domain binding glutamate rich protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001001713.1		Intron			NP_001001713.1
NM_001317740.1		Intron			NP_001304669.1
NM_001317741.1		Intron			NP_001304670.1
NM_001317742.1		Intron			NP_001304671.1
NM_007341.2		Intron			NP_031367.1

Gene: WRB-SH3BGR
Gene Name: WRB-SH3BGR readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001317744.1		Intron			NP_001304673.1

View Full Product Details