Product Details

SNP ID
rs121909628
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.8:38414892 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
AGGACATTCCTGGCTGCCAGGTCTC[G/A]GTGTATGCACTGAGGAAGGAGGAAG
Phenotype
MIM: 136350
Polymorphism
G/A, Transition substitution
Allele Nomenclature
Literature Links
FGFR1 PubMed Links

Gene Details

Gene
FGFR1
Gene Name
fibroblast growth factor receptor 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001174063.1 1699 Missense Mutation NP_001167534.1
NM_001174064.1 1699 Missense Mutation NP_001167535.1
NM_001174065.1 1699 Missense Mutation NP_001167536.1
NM_001174066.1 1699 Missense Mutation NP_001167537.1
NM_001174067.1 1699 Missense Mutation NP_001167538.1
NM_015850.3 1699 Missense Mutation NP_056934.2
NM_023105.2 1699 Missense Mutation NP_075593.1
NM_023106.2 1699 Missense Mutation NP_075594.1
NM_023110.2 1699 Missense Mutation NP_075598.2
XM_006716303.2 1699 Nonsense Mutation XP_006716366.1
XM_006716304.1 1699 Nonsense Mutation XP_006716367.1
XM_006716306.2 1699 Nonsense Mutation XP_006716369.1
XM_006716307.1 1699 Nonsense Mutation XP_006716370.1
XM_006716309.3 1699 Nonsense Mutation XP_006716372.1
XM_006716310.2 1699 Nonsense Mutation XP_006716373.1
XM_006716311.1 1699 Nonsense Mutation XP_006716374.1
XM_006716312.1 1699 Nonsense Mutation XP_006716375.1
XM_006716313.2 1699 Nonsense Mutation XP_006716376.1
XM_006716314.1 1699 Nonsense Mutation XP_006716377.1
XM_011544443.2 1699 Nonsense Mutation XP_011542745.1
XM_011544444.1 1699 Nonsense Mutation XP_011542746.1
XM_011544445.2 1699 Nonsense Mutation XP_011542747.1
XM_011544446.2 1699 Nonsense Mutation XP_011542748.1
XM_011544447.2 1699 Nonsense Mutation XP_011542749.1
XM_011544448.1 1699 Nonsense Mutation XP_011542750.1
XM_011544449.1 1699 Nonsense Mutation XP_011542751.1
XM_011544450.2 1699 Nonsense Mutation XP_011542752.1
XM_011544451.1 1699 Nonsense Mutation XP_011542753.1
XM_011544452.2 1699 Intron XP_011542754.1
XM_017013219.1 1699 Nonsense Mutation XP_016868708.1
XM_017013220.1 1699 Nonsense Mutation XP_016868709.1
XM_017013221.1 1699 Nonsense Mutation XP_016868710.1
XM_017013222.1 1699 Nonsense Mutation XP_016868711.1
XM_017013223.1 1699 Nonsense Mutation XP_016868712.1
XM_017013224.1 1699 Nonsense Mutation XP_016868713.1
XM_017013225.1 1699 Nonsense Mutation XP_016868714.1
XM_017013226.1 1699 Nonsense Mutation XP_016868715.1
XM_017013227.1 1699 Nonsense Mutation XP_016868716.1
XM_017013228.1 1699 Nonsense Mutation XP_016868717.1
XM_017013229.1 1699 Nonsense Mutation XP_016868718.1
XM_017013230.1 1699 Nonsense Mutation XP_016868719.1
XM_017013231.1 1699 Intron XP_016868720.1
Gene
LETM2
Gene Name
leucine zipper and EF-hand containing transmembrane protein 2
There are no transcripts associated with this gene.

View Full Product Details